Stem-loop sequence osa-MIR5073

AccessionMI0017946 (change log)
DescriptionOryza sativa miR5073 stem-loop
Literature search

1 open access papers mention osa-MIR5073
(3 sentences)

Stem-loop
   --aua   auua      u   -u           uuucaauu        aaagu 
5'      aga    guuugg gaa  cggaaacuauu        uuauagaa     c
        |||    |||||| |||  |||||||||||        ||||||||     c
3'      ucu    caaacc cuu  gcuuuugauaa        aguauuuu     a
   ucaaa   --gc      c   uu           ---uaacu        aaugu 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 19020495-19020601 [+]
intergenic
Database links

Mature sequence osa-miR5073

Accession MIMAT0020555
Sequence

11 - 

guuuggugaaucggaaacuauuu

 - 33

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).