|
miRBase |
|
Stem-loop sequence bdi-MIR5055 |
|||||
| Accession | MI0017944 | ||||
| Description | Brachypodium distachyon miR5055 stem-loop | ||||
| Stem-loop |
gguu -- c c gc - gcguugcaaggagcagaguauuuaaccugcgccgacaguuguuaaacaggcaaggugggacuaaaaagggugucgccuacuguacug acaa gcucu gcug uga ucgg cguu g |||| ||||| |||| ||| |||| |||| c uguu cggga cgac gcu agcu gcaa u --uu ac - c au u aacugggcacgggucaaaauauuuguccguucaggucauacgguugccgggucgacgccacgcggugugucgggucaacgguagcgg |
||||
| Comments |
This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1]. |
||||
| Genome context |
|
||||
Mature sequence bdi-miR5055 |
|
| Accession | MIMAT0020553 |
| Sequence |
11 - ucucgcugcugagcucggcgu - 31 |
| Evidence | not experimental |
References |
|
| 1 |
PMID:21352554
"Discovery of barley miRNAs through deep sequencing of short reads"
BMC Genomics. 12:129(2011).
|