Stem-loop sequence osa-MIR5072

AccessionMI0017943 (change log)
DescriptionOryza sativa miR5072 stem-loop
Literature search

7 open access papers mention osa-MIR5072
(14 sentences)

Stem-loop
   -----   gaaua a      ccc   cg    c     aaa 
5'      gcu     g ucgauu   cag  gagu gccaa   u
        |||     | ||||||   |||  |||| |||||    
3'      cga     c agcuga   guu  uuca cgguu   c
   uagca   ----a -      aca   uu    a     gug 
Get sequence
Deep sequencing
242 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 17458695-17458770 [-]
intergenic
Database links

Mature sequence osa-miR5072

Accession MIMAT0020552
Sequence

12 - 

cgauuccccagcggagucgcca

 - 33

Get sequence
Deep sequencing183 reads, 2 experiments
Evidence not experimental
Database links

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).