Stem-loop sequence osa-MIR5071

AccessionMI0017942 (change log)
DescriptionOryza sativa miR5071 stem-loop
Literature search

1 open access papers mention osa-MIR5071
(1 sentences)

Stem-loop
   gaacagau   -      --c    u   -gu  a    gcaaccauauaca 
5'         caa aucaag   auca auc   gg cacg             u
           ||| ||||||   |||| |||   || ||||              
3'         guu uaguuc   uagu uag   cc gugc             a
   -ccuccau   a      cca    -   auu  -    gauauuacuuccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 4114004-4114102 [-]
intergenic
Database links

Mature sequence osa-miR5071

Accession MIMAT0020551
Sequence

13 - 

ucaagcaucauaucguggaca

 - 33

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).