Stem-loop sequence mmu-mir-5046

AccessionMI0017931 (change log)
Symbol MGI:Mir5046
DescriptionMus musculus miR-5046 stem-loop
Stem-loop
   u  ua       ccac  u  c c   ua 
5'  cc  gcucccg    ug ga c ccu  c
    ||  |||||||    || || | |||  c
3'  gg  cgagggc    gc cu g gga  u
   u  uc       -cua  -  c a   uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 6829886-6829944 [-]
sense
ENSMUST00000170516 ; Rps6ka4-202; 3'UTR (exon 17)
ENSMUST00000025903 ; Rps6ka4-201; 3'UTR (exon 17)
Database links

Mature sequence mmu-miR-5046

Accession MIMAT0020540
Sequence

5 - 

agcucccgccacugugacccccuu

 - 28

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:21295561 "Mesenchymal miR-21 regulates branching morphogenesis in murine submandibular gland in vitro" Hayashi T, Koyama N, Azuma Y, Kashimata M Dev Biol. 352:299-307(2011).