Stem-loop sequence gma-MIR167i

AccessionMI0017926 (change log)
DescriptionGlycine max miR167i stem-loop
Gene family MIPF0001352; MIR167
Literature search

26 open access papers mention gma-MIR167i
(190 sentences)

Stem-loop
   -------------------------------------------------------------ca        g    a      -        gau      a  g 
5'                                                                acuacuag ugaa cugcca caugaucu   cuuucc cg c
                                                                  |||||||| |||| |||||| ||||||||   |||||| || a
3'                                                                ugaugguc acuu gacggu guacuaga   gaaggg gu a
   aauggaaaaucuugugaacaagaccaagaacaagaaggguuauagacagaugguaguacgugg        a    c      c        auu      a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 39002038-39002188 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR167i
gma-MIR167echr20: 39002092-39002200 [+]
gma-MIR167ichr20: 39002038-39002188 [-]
Database links

Mature sequence gma-miR167i

Accession MIMAT0021076
Sequence

63 - 

ucaugcuggcagcuucaacuggu

 - 85

Get sequence
Evidence experimental; SOLiD [1]

References

1