Stem-loop sequence gma-MIR5044

AccessionMI0017925 (change log)
DescriptionGlycine max miR5044 stem-loop
Gene family MIPF0001288; MIR5037
Stem-loop
   -----------------------------------------------------------------ua    -    aa    u        ug a      ugu  uuu 
5'                                                                    gugg ccuc  aggc uccacuac  c uguuuc   gg   a
                                                                      |||| ||||  |||| ||||||||  | ||||||   ||    
3'                                                                    uacc ggag  uccg aggugaug  g acaaag   cc   a
   agugucauaaaccgauguuuuauauaacaucuuuaaagucuccuauuuuuguacucguaacgaaaau    u    -a    u        gu a      --u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 57357782-57357932 [-]
intergenic
Database links

Mature sequence gma-miR5044

Accession MIMAT0021075
Sequence

62 - 

guaguggaugccuagaggucca

 - 83

Get sequence
Evidence experimental; SOLiD [1], Illumina [2-3]

References

1
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3