Stem-loop sequence gma-MIR4372b

AccessionMI0017923 (change log)
DescriptionGlycine max miR4372b stem-loop
Gene family MIPF0001062; MIR1521
Stem-loop
   -------------------------------------------------------------------uc  c         a           g     cguuaauua 
5'                                                                      gu augugucac auuuuauuaga guuga         a
                                                                        || ||||||||| ||||||||||| |||||          
3'                                                                      ca uguacagug uaaaauaaucu caauu         g
   auuagaguuuuaaccugcaauuaacuaauagaacuggcaguucacaacacaaaaauaaccugcaacuaa  a         c           a     aaacuacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 51223300-51223450 [+]
intergenic
Database links

Mature sequence gma-miR4372b

Accession MIMAT0021073
Sequence

61 - 

uaauaaaaucgugacauguaac

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1