Stem-loop sequence gma-MIR5042

AccessionMI0017922 (change log)
DescriptionGlycine max miR5042 stem-loop
Stem-loop
   aaagaugcaaaauuuucaaguguucaaguguugacaacuauuuuuagcuuucaaaccc              c         ----    au 
5'                                                           ccuaucuuggauca agccccauu    gccu  c
                                                             |||||||||||||| |||||||||    ||||   
3'                                                           ggauagaaccuagu ucgggguga    cggg  a
   ------------------------------gucaaguaugaaaguucgaaaggucgaa              -         gguu    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 10449468-10449618 [+]
intergenic
Database links

Mature sequence gma-miR5042-5p

Accession MIMAT0021072
Previous IDsgma-miR5042
Sequence

61 - 

uaucuuggaucacagccccauu

 - 82

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence gma-miR5042-3p

Accession MIMAT0032123
Sequence

103 - 

uggggcuugauccaagauagg

 - 123

Get sequence
Evidence experimental; Illumina [2]

References

1
2