Stem-loop sequence gma-MIR396g

AccessionMI0017921 (change log)
DescriptionGlycine max miR396g stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396g
(142 sentences)

Stem-loop
   augcugugugugugagaucugagcucaauuuuccucucaaguccug      c                   a     uau  aucuuauaucucuc 
5'                                               gucaug uuuuccacagcuuucuuga cuucu   gc              c
                                                 |||||| ||||||||||||||||||| |||||   ||              a
3'                                               cgguau agagggugucgaaagaacu gaaga   cg              c
   ----------------------------------------------      a                   c     ucc  aauuuuacgaccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR396g

Accession MIMAT0021071
Sequence

66 - 

uucuugaacuucuuaugcauc

 - 86

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).