Stem-loop sequence gma-MIR396f

AccessionMI0017919 (change log)
DescriptionGlycine max miR396f stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396f
(142 sentences)

Stem-loop
   uagcuucuucagcauuucaacuuccaugcuugcuugaaca       ------u    c         gc             uu     uaau   gcu 
5'                                         aguccug       uaug uuuuccaca  uuucuugaacuuc  augcc    gca   a
                                           |||||||       |||| |||||||||  |||||||||||||  |||||    |||    
3'                                         ucaggau       guac aaaaggugu  aaagaauuugaag  uacgg    ugu   u
   ----------------------------------------       cuaaacu    a         aa             -u     ----   agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 556336-556486 [-]
intergenic
Database links

Mature sequence gma-miR396f

Accession MIMAT0021069
Sequence

62 - 

agcuuucuugaacuucuuaugccua

 - 86

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).