Stem-loop sequence gma-MIR169i

AccessionMI0017918 (change log)
DescriptionGlycine max miR169i stem-loop
Gene family MIPF0001058; MIR169_6
Literature search

23 open access papers mention gma-MIR169i
(96 sentences)

Stem-loop
   --------------------------------------------------------------------auu    c         uu       uau  auaaaaa   a  a 
5'                                                                        ugag cgggauggc  gccggca   gc       gca ag u
                                                                          |||| |||||||||  |||||||   ||       ||| || c
3'                                                                        acuc gcccuaccg  uggccgu   cg       ugu uc c
   ucuuccguguuaccuauggcauuuacuucgagaaaaguuucagaguguacucacacauuucccucguuuau    u         --       --u  ------g   g  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 21505359-21505509 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169i
gma-MIR169ochr13: 21496986-21497084 [+]
gma-MIR169ichr13: 21505359-21505509 [+]
Database links

Mature sequence gma-miR169i-5p

Accession MIMAT0022983
Sequence

4 - 

ugagccgggauggcuugccggca

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR169i-3p

Accession MIMAT0021068
Previous IDsgma-miR169i
Sequence

62 - 

ccggugccaucccgucucaua

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).