Stem-loop sequence gma-MIR5040

AccessionMI0017917 (change log)
DescriptionGlycine max miR5040 stem-loop
Stem-loop
   uaguuuggauaauaagcuuuuuagauaggaaacucaaugagaauauuacu    g ag    -ugau         g   gagg     a 
5'                                                   gauu a  guca     auauaacaa cau    auaua a
                                                     |||| |  ||||     ||||||||| |||    ||||| u
3'                                                   cuaa u  uagu     uguguuguu gua    uauau g
   -----------------------------aaaguaagggggccaaguaau    g ga    ugguu         -   -aca     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 37310768-37310918 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5040
gma-MIR4348achr12: 37311016-37311160 [-]
gma-MIR5040chr12: 37310768-37310918 [-]
Database links

Mature sequence gma-miR5040

Accession MIMAT0021067
Sequence

62 - 

augauauauaacaagcaugag

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1