|
miRBase |
|
Stem-loop sequence gma-MIR167h |
||||||
| Accession | MI0017914 | |||||
| Description | Glycine max miR167h stem-loop | |||||
| Gene family | MIPF0001352; MIR167 | |||||
| Stem-loop |
aacuacuaggugaaacugccacaugaucugaucuuuccacagcaagugagggaagu ag ug a uca ua aucaugc gc gcu a || ||||||| || ||| c au uaguacg ug uga u ------auguaguaguggaaaaucuugugaacaagaacaagaaggguuauagacag gg -- g ugg |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence gma-miR167h |
|
| Accession | MIMAT0021064 |
| Sequence |
61 - aucaugcuggcagcuucaacuggu - 84 |
| Evidence | experimental; 454 [1], SOLiD [2] |
References |
|
| 1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
| 2 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|