Stem-loop sequence gma-MIR5038a

AccessionMI0017913 (change log)
DescriptionGlycine max miR5038a stem-loop
Gene family MIPF0001368; MIR5038
Stem-loop
   ugggcauccauuuuucccaaauuucagaacuguuuuagguugaa     c                     c          g  u       aa 
5'                                             cuucu uaaauuuucuugagaauuugg cucuguccau uc aauuauu  u
                                               ||||| ||||||||||||||||||||| |||||||||| || |||||||   
3'                                             gaaga guuuaagagaacucuuaaacc gagauaggua ag uuaauaa  u
   ----------------------------------------aaac     u                     c          g  -       cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 30857860-30858010 [+]
intergenic
Database links

Mature sequence gma-miR5038a

Accession MIMAT0021063
Sequence

61 - 

ugagaauuuggccucugucca

 - 81

Get sequence
Evidence experimental; SOLiD [1], Illumina [2-3]

References

1
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).