Stem-loop sequence gma-MIR169h

AccessionMI0017912 (change log)
DescriptionGlycine max miR169h stem-loop
Gene family MIPF0001058; MIR169_6
Literature search

23 open access papers mention gma-MIR169h
(97 sentences)

Stem-loop
   ----------------------------------------------------------------- ug  uu         g   a          uau   --u  u 
5'                                                                  g  cu  ugagccaag aug cuugccggcg   guu   ga c
                                                                    |  ||  ||||||||| ||| ||||||||||   |||   || u
3'                                                                  c  gg  acucgguuc uac gagcggccgu   cag   cu c
   guguuaauaaccuguaguaggaaaguuaguucgagaaagaucucagaguauacucaccuuucucu gu  uu         -   a          ugu   gau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 5330689-5330839 [+]
intergenic
Database links

Mature sequence gma-miR169h

Accession MIMAT0021062
Sequence

61 - 

ggcgagacaucuuggcucauu

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1