Stem-loop sequence gma-MIR5037a

AccessionMI0017910 (change log)
Previous IDsgma-MIR5037
DescriptionGlycine max miR5037 stem-loop
Gene family MIPF0001288; MIR5037
Stem-loop
   aauaaacaaguuucuuauaggucuaugcaugaaguuguacauagagca       u     -    aa    u           a      uguc  uuua 
5'                                                 ugcuuuu agugg ccuc  aggc uccacuacugc uguuuc    gg    a
                                                   ||||||| ||||| ||||  |||| ||||||||||| ||||||    ||     
3'                                                 acggaaa uuacc ggag  uccg aggugaugaug acaaag    cc    u
   -----------------------------------------------a       -     u    -g    u           a      ---u  uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 47688219-47688369 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5037a
gma-MIR5037dchr8: 47682569-47682674 [+]
gma-MIR5037achr8: 47688219-47688369 [+]
Database links

Mature sequence gma-miR5037a

Accession MIMAT0021060
Previous IDsgma-miR5037
Sequence

61 - 

gccucaaaggcuuccacuacug

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1