Stem-loop sequence gma-MIR5036

AccessionMI0017909 (change log)
DescriptionGlycine max miR5036 stem-loop
Gene family MIPF0000216; MIR477
Stem-loop
   --------------------------------------------------------   gg uga     c    uc              c -   uaa au 
5'                                                         agg  u   uuguu acuc  ccucaagggcuucu g cuu   c  c
                                                           |||  |   ||||| ||||  |||||||||||||| | |||   |   
3'                                                         ucc  g   aauaa ugag  gggguucccggaga c gaa   g  c
   aauacuuccacucuuuguucuacuugaagaaacacaauauauauauauauauauau   uu ucg     a    ga              u a   caa aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 1774168-1774318 [+]
intergenic
Database links

Mature sequence gma-miR5036

Accession MIMAT0021059
Sequence

61 - 

agaggcccuuggggaggaguaa

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1