Stem-loop sequence gma-MIR5035

AccessionMI0017908 (change log)
DescriptionGlycine max miR5035 stem-loop
Stem-loop
   aucagcuuaggcuugucuacugaaaaucauauaaac           c    c                                      a 
5'                                     auauguaccua cuau cuaugagcuucuaaacauuuuuucccuuaugccaaaga a
                                       ||||||||||| |||| |||||||||||||||||||||||||||||||||||||| a
3'                                     uauacauggau gaua gauacucgaagauuuguaaaaaagggaguacgguuucu c
   ------------------------------------           a    a                                      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 1959028-1959178 [+]
intergenic
Database links

Mature sequence gma-miR5035-5p

Accession MIMAT0021058
Previous IDsgma-miR5035
Sequence

61 - 

cuucuaaacauuuuuucccuua

 - 82

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence gma-miR5035-3p

Accession MIMAT0032121
Sequence

118 - 

uguuuagaagcucauagaauagau

 - 141

Get sequence
Evidence experimental; Illumina [2]

References

1
2