Stem-loop sequence gma-MIR171i

AccessionMI0017907 (change log)
DescriptionGlycine max miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

16 open access papers mention gma-MIR171i
(37 sentences)

Stem-loop
   uuaaaggcaagcuugguggaaaugagagguagaggggaccgguucaacgg        uc         a        au      aa 
5'                                                   gauauugg  cgguucaau agaaagca  gcucaa  u
                                                     ||||||||  ||||||||| ||||||||  ||||||  g
3'                                                   cuauaacc  gccgaguua uuuuuugu  uggguu  u
   ----------------------------ccauacuucucuucacaaagca        gu         c        cc      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 49520830-49520980 [-]
intergenic
Database links

Mature sequence gma-miR171i-5p

Accession MIMAT0021056
Sequence

68 - 

auaagaaagcaaugcucaaa

 - 87

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

Mature sequence gma-miR171i-3p

Accession MIMAT0021057
Sequence

112 - 

uugagccgugccaauaucacg

 - 132

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).