Stem-loop sequence gma-MIR5034

AccessionMI0017906 (change log)
DescriptionGlycine max miR5034 stem-loop
Stem-loop
   ---------------------------------------------cgacacuguagaaacaguaaaaa     u      -     a  -     uuc 
5'                                                                     uugag cuauuu aaagg gu ccucg   c
                                                                       ||||| |||||| ||||| || |||||   c
3'                                                                     aacuc gauaga uuucc ca ggagu   u
   uaacuauacccguaucuucgaauguuucucaaaaaggauccgucucgaagagagagauuuuggaccaa     u      c     -  u     guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 46560092-46560242 [+]
intergenic
chr6: 46562415-46562565 [+]
intergenic
Database links

Mature sequence gma-miR5034

Accession MIMAT0021055
Sequence

61 - 

gguacccuuucagauagucuca

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1