Stem-loop sequence gma-MIR171h

AccessionMI0017905 (change log)
DescriptionGlycine max miR171h stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

16 open access papers mention gma-MIR171h
(43 sentences)

Stem-loop
   ----------------------------------------------    --         c  c           a      a        caaccac 
5'                                               gcaa  aaguagaca gg gugauauuggu cggcuc ucuuaauu       u
                                                 ||||  ||||||||| || ||||||||||| |||||| ||||||||        
3'                                               cguu  uucguuugu uc cacuauaacua gccgag agaguuag       a
   cguaucaaaccaaagauuucuuuuucgacgaucauauauauauaua    ac         -  u           a      c        caacuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 10887944-10888094 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR171h
gma-MIR171hchr6: 10887944-10888094 [-]
gma-MIR171schr6: 10887673-10887774 [-]
Database links

Mature sequence gma-miR171h

Accession MIMAT0021054
Sequence

62 - 

auugagacgagccgaaucaau

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1