Stem-loop sequence gma-MIR5033

AccessionMI0017904 (change log)
DescriptionGlycine max miR5033 stem-loop
Stem-loop
   ----------------------------------------------------------------------  -         caa         u  -guuaga g  guu 
5'                                                                       gu guuuuuuuu   gcagccaug gu       u au   u
                                                                         || |||||||||   ||||||||| ||       | ||    
3'                                                                       ca caaaggaaa   ugucggugc ca       a ua   g
   gaaucuguguagggguaguaaacuaaaaaaagaguagaaugucaaccugccguuacaaacaaaacgcuuu  u         aca         -  aaagaag g  aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 47362703-47362853 [+]
intergenic
Database links

Mature sequence gma-miR5033

Accession MIMAT0021053
Sequence

61 - 

ggcuguacaaaaggaaacuac

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1