Stem-loop sequence gma-MIR5032

AccessionMI0017903 (change log)
DescriptionGlycine max miR5032 stem-loop
Stem-loop
   gacaccaaagauagggauauuaaacgaauggaauuaguauauggauguaauauaaugaaa      ca    --u -      ---     aaa 
5'                                                             uagagc  cuuu   g gguucc   cuaug   u
                                                               ||||||  ||||   | ||||||   |||||    
3'                                                             auuuug  gaag   c ccgagg   gauac   g
   ---------------------------------acuugagcuucaaaggaagcauugagc      aa    ugu a      aaa     gga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 35292552-35292702 [-]
intergenic
Database links

Mature sequence gma-miR5032

Accession MIMAT0021052
Sequence

62 - 

agagccacuuuuggguucccuau

 - 84

Get sequence
Evidence experimental; SOLiD [1]

References

1