Stem-loop sequence gma-MIR5031

AccessionMI0017901 (change log)
DescriptionGlycine max miR5031 stem-loop
Stem-loop
   uguuuaauaaaaucgugacauguaacgauaaacguuuaauaaaauagugaagguagac    a    --    ca        --cua    gg g 
5'                                                           aauu auga  uuaa  ucuaauuu     gauu  g a
                                                             |||| ||||  ||||  ||||||||     ||||  | u
3'                                                           uuaa ugcu  aauu  ggguuaaa     uuag  c a
   ----------------------------------------acuaggagauaaauaaaa    a    ua    ag        aaaua    ga a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 54737918-54738068 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5031
gma-MIR1529chr1: 54737797-54737997 [-]
gma-MIR5031chr1: 54737918-54738068 [+]
Database links

Mature sequence gma-miR5031

Accession MIMAT0021050
Sequence

61 - 

uuaaugauuaacaucuaauuu

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1