Stem-loop sequence hsa-mir-5010

Accession MI0017878
Description Homo sapiens miR-5010 stem-loop
Stem-loop 
gauc     a   c    --  --a         c   -          uggccuacagcugc 
    caggg acc uaga  gc   gggggaugg aga gcaaaauuca              c
    ||||| ||| ||||  ||   ||||||||| ||| ||||||||||              u
    guuuc ugg gucu  cg   ccccuuacc ucu uguuuuaggu              c
----     g   a    gu  aga         c   g          cacgucaaaccguu
Get sequence
Deep sequencing
336 reads, 19 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 40666206-40666325 [+]
sense
ENST00000544137 ; ATP6V0A1-205; intron 13
ENST00000544137 ; ATP6V0A1-205; 3'UTR (exon 14)
ENST00000544137 ; ATP6V0A1-205; 3'UTR (exon 14)
ENST00000537728 ; ATP6V0A1-204; intron 18
ENST00000393829 ; ATP6V0A1-203; intron 19
ENST00000264649 ; ATP6V0A1-201; intron 19
ENST00000537728 ; ATP6V0A1-204; 3'UTR (exon 19)
ENST00000537728 ; ATP6V0A1-204; 3'UTR (exon 19)
ENST00000343619 ; ATP6V0A1-202; intron 20
ENST00000546249 ; ATP6V0A1-206; intron 20
ENST00000264649 ; ATP6V0A1-201; 3'UTR (exon 20)
ENST00000393829 ; ATP6V0A1-203; 3'UTR (exon 20)
ENST00000264649 ; ATP6V0A1-201; 3'UTR (exon 20)
ENST00000393829 ; ATP6V0A1-203; 3'UTR (exon 20)
ENST00000343619 ; ATP6V0A1-202; 3'UTR (exon 21)
ENST00000546249 ; ATP6V0A1-206; 3'UTR (exon 21)
ENST00000343619 ; ATP6V0A1-202; 3'UTR (exon 21)
ENST00000546249 ; ATP6V0A1-206; 3'UTR (exon 21)

Mature sequence hsa-miR-5010-5p

Accession MIMAT0021043
Sequence

21 -  

agggggauggcagagcaaaauu

 - 42

Get sequence
Deep sequencing 319 reads, 12 experiments
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-5010-3p

Accession MIMAT0021044
Sequence

80 -  

uuuugugucucccauuccccag

 - 101

Get sequence
Deep sequencing 16 reads, 8 experiments
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).