Stem-loop sequence hsa-mir-548ao

AccessionMI0017871 (change log)
Symbol HGNC:MIR548AO
DescriptionHomo sapiens miR-548ao stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ao
(170 sentences)

Stem-loop
   ---      ucu       a          ac            a    a 
5'    aacuau   uagguug ugcagaagua  uacgguuuuugc guug a
      ||||||   ||||||| ||||||||||  |||||||||||| ||||  
3'    uugaua   auccgac acguuuucau  gugccagaaacg uaau a
   ucu      ---       a          ca            g    g 
Get sequence
Deep sequencing
124 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 41271048-41271143 [-]
intergenic
Database links

Mature sequence hsa-miR-548ao-5p

Accession MIMAT0021029
Sequence

21 - 

agaaguaacuacgguuuuugca

 - 42

Get sequence
Deep sequencing19 reads, 14 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548ao-3p

Accession MIMAT0021030
Sequence

58 - 

aaagaccgugacuacuuuugca

 - 79

Get sequence
Deep sequencing87 reads, 24 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).