|
miRBase |
|
Stem-loop sequence gma-MIR1513b |
|||||
| Accession | MI0017856 | ||||
| Description | Glycine max miR1513b stem-loop | ||||
| Stem-loop |
ugc u a a ug - a gu uguaa ucaug cuuucucu uau cuc u || ||||| ||||| |||||||| ||| ||| ca acauu aguac gaaagaga aua gag c --- c c c gu u u |
||||
| Genome context |
|
||||
Mature sequence gma-miR1513b |
|
| Accession | MIMAT0021008 |
| Sequence |
46 - ugagagaaagccaugacuuac - 66 |
| Evidence | experimental; 454 [1], Solexa [2] |
References |
|
| 1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
| 2 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|