Stem-loop sequence gma-MIR1507c

AccessionMI0017854 (change log)
DescriptionGlycine max miR1507c stem-loop
Literature search

17 open access papers mention gma-MIR1507c
(38 sentences)

Stem-loop 
   -----  c    -               a   u   auu       a 
5'      ug uaga gguguuugggaugag gaa aga   uuuucaa u
        || |||| ||||||||||||||| ||| |||   |||||||  
3'      ac aucu cuacaaaccuuacuc cuu ucu   gaaaguu g
   uacac  a    a               c   c   agu       c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 17134380-17134469 [-]
intergenic
Database links

Mature sequence gma-miR1507c-5p

Accession MIMAT0021005
Previous IDsgma-miR1507c*
Sequence

6 -  

gagguguuugggaugagagaa

 - 26

Get sequence
Evidence experimental; SOLiD [2], Illumina [3-4]

Mature sequence gma-miR1507c-3p

Accession MIMAT0021006
Previous IDsgma-miR1507c
Sequence

62 -  

ccucauuccaaacaucaucu

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [3,5]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
5
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).