![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1507c |
|||||
Accession | MI0017854 (change log) | ||||
Description | Glycine max miR1507c stem-loop | ||||
Literature search |
![]()
17 open access papers mention gma-MIR1507c | ||||
Stem-loop |
----- c - a u auu a 5' ug uaga gguguuugggaugag gaa aga uuuucaa u || |||| ||||||||||||||| ||| ||| ||||||| 3' ac aucu cuacaaaccuuacuc cuu ucu gaaaguu g uacac a a c c agu c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1507c-5p |
|
Accession | MIMAT0021005 |
Previous IDs | gma-miR1507c* |
Sequence |
6 - gagguguuugggaugagagaa - 26 |
Evidence | experimental; SOLiD [2], Illumina [3-4] |
Mature sequence gma-miR1507c-3p |
|
Accession | MIMAT0021006 |
Previous IDs | gma-miR1507c |
Sequence |
62 - ccucauuccaaacaucaucu - 81 |
Evidence | experimental; 454 [1], Illumina [3,5] |
References |
|
1 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
2 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
4 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
5 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|