Stem-loop sequence gma-MIR482c

AccessionMI0017851 (change log)
DescriptionGlycine max miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

21 open access papers mention gma-MIR482c
(46 sentences)

Stem-loop
   -    u ug           -u         guaau         ca 
5'  agaa u  ugggaaugggc  gauugggaa     gagauugag  a
    |||| |  |||||||||||  |||||||||     |||||||||  u
3'  ucuu a  auccuuacccg  uuaacccuu     cuuuaauuu  a
   g    u gu           cc         -----         ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 57154765-57154854 [-]
intergenic
Database links

Mature sequence gma-miR482c-5p

Accession MIMAT0021001
Sequence

4 - 

auuugugggaaugggcugauugg

 - 26

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence gma-miR482c-3p

Accession MIMAT0021002
Sequence

60 - 

uucccaauuccgcccauuccu

 - 80

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3