Stem-loop sequence gma-MIR394c

AccessionMI0017846 (change log)
DescriptionGlycine max miR394c stem-loop
Gene family MIPF0000100; MIR394
Literature search

9 open access papers mention gma-MIR394c
(13 sentences)

Stem-loop
   cagag   c      u c           acuuccacuuuc  uu   --u   ucu 
5'      uuu uuggca u uguccaccucc            ag  cca   gga   c
        ||| |||||| | |||||||||||            ||  |||   |||    
3'      aga aaccgu a acagguggagg            uc  ggu   ucu   u
   ----g   u      c u           cucaugcaucua  cc   uuu   cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 1556919-1557028 [-]
intergenic
Database links

Mature sequence gma-miR394c-5p

Accession MIMAT0020996
Sequence

10 - 

uuggcauucuguccaccucc

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).