Stem-loop sequence gma-MIR171g

AccessionMI0017841 (change log)
DescriptionGlycine max miR171g stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171g
(36 sentences)

Stem-loop
   --------          u           a       uuu    aga 
5'         ugauguuggc uggcucaauca auuaaaa   uuaa   u
           |||||||||| ||||||||||| |||||||   ||||    
3'         acuauaaccg gccgaguuagu uaguuuu   aauu   u
   cuacuuau          u           c       uuc    guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 5376139-5376228 [-]
intergenic
Database links

Mature sequence gma-miR171g

Accession MIMAT0020991
Sequence

61 - 

ugauugagccgugccaauauc

 - 81

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).