Stem-loop sequence gma-MIR171f

AccessionMI0017840 (change log)
DescriptionGlycine max miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171f
(36 sentences)

Stem-loop
   --------ga                       -   c  u     aug 
5'           gauauugguacgguucaaucaga agg ag gcuuu   a
             ||||||||||||||||||||||| ||| || |||||    
3'           cuauaaccgugccgaguuaguuu uuc uc cgaaa   u
   caaacguaca                       a   -  u     cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 8505075-8505164 [-]
intergenic
Database links

Mature sequence gma-miR171f

Accession MIMAT0020990
Sequence

60 - 

ugauugagccgugccaauauc

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).