Stem-loop sequence gma-MIR171d

AccessionMI0017838 (change log)
DescriptionGlycine max miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

15 open access papers mention gma-MIR171d
(36 sentences)

Stem-loop
   -   cau  u c       u  gu   c     ----  c     ---       ucac 
5'  agc   ug g uauuggc cg  uca ucaga    ca aaaac   aaccaua    a
    |||   || | ||||||| ||  ||| |||||    || |||||   |||||||     
3'  ucg   ac c auaacug gc  agu aguuu    gu uuuug   uuggugu    a
   a   -uc  u u       u  ug   u     cuaa  -     cuu       uuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 49981490-49981599 [-]
intergenic
Database links

Mature sequence gma-miR171d

Accession MIMAT0020988
Sequence

81 - 

ugauugagucgugucaauauc

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).