Stem-loop sequence gma-MIR169g

AccessionMI0017837 (change log)
DescriptionGlycine max miR169g stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

24 open access papers mention gma-MIR169g
(104 sentences)

Stem-loop
   aag       c         ug         ------  c  u     uaaacaauaa     aucu 
5'    uagagug agccaagga  acuugccgg      ag aa aagaa          aaugu    a
      ||||||| |||||||||  |||||||||      || || |||||          |||||    u
3'    guuuuac ucgguucuu  ugaacggcc      uc uu uucuu          uuaca    u
   uuu       a         gu         gcacuu  -  c     cuucuucuuc     auau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 4591798-4591927 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR169g
gma-MIR169schr17: 4594138-4594257 [-]
gma-MIR169gchr17: 4591798-4591927 [-]
gma-MIR169rchr17: 4587059-4587161 [-]
Database links

Mature sequence gma-miR169g

Accession MIMAT0020987
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).