Stem-loop sequence gma-MIR169f

AccessionMI0017836 (change log)
DescriptionGlycine max miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169f
(101 sentences)

Stem-loop
   ga       c       c       g     c        au            uu   caaguga     ca                a 
5'   acuugca gaagagg agagagu uagug agccaagg  gacuugccggca  agc       augag  ucauauauauauauau u
     ||||||| ||||||| ||||||| ||||| ||||||||  ||||||||||||  |||       |||||  ||||||||||||||||  
3'   ugaaugu cuuuucu ucucuca guuau ucgguucc  uugaacggcugu  uug       uacuc  aguauauauauauaua a
   --       a       -       g     a        gg            uc   -------     --                u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 40892477-40892646 [-]
intergenic
Database links

Mature sequence gma-miR169f

Accession MIMAT0020986
Sequence

32 - 

cagccaaggaugacuugccgg

 - 52

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).