Stem-loop sequence gma-MIR166h

AccessionMI0017834 (change log)
DescriptionGlycine max miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

37 open access papers mention gma-MIR166h
(215 sentences)

Stem-loop
   u    a           uu      cu      a  -----u c          uuuu     u             aauuua    u   uu    uc 
5'  gggg ugaugggaaug  guuugg  cgaggu ac      g auggucuuaa    guuca cuuuugaagcuuu      uuua ggg  ucaa  u
    |||| |||||||||||  ||||||  |||||| ||      | ||||||||||    ||||| |||||||||||||      |||| |||  ||||   
3'  uucc acugcccuuac  cggacc  gcucua ug      c uaucggaguu    uaggu ggaaauuucgaaa      aagu ccc  aguu  u
   -    a           uu      ag      g  uauuuc c          ---u     u             aagaca    u   -u    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 14920990-14921179 [+]
intergenic
Database links

Mature sequence gma-miR166h-5p

Accession MIMAT0020983
Sequence

12 - 

ggaauguuguuuggcucgagg

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR166h-3p

Accession MIMAT0020984
Sequence

160 - 

ucucggaccaggcuucauucc

 - 180

Get sequence
Evidence experimental; 454 [1], Illumina [2-3]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).