Stem-loop sequence gma-MIR166g

AccessionMI0017833 (change log)
DescriptionGlycine max miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166g
(215 sentences)

Stem-loop
   -----aaa              uc                    u c   u   cuca 
5'         aguugaggggaaug  guuugguucgagaucauuca g aag agu    g
           ||||||||||||||  |||||||||||||||||||| | ||| |||     
3'         ucgacuccccuuac  cggaccaggcuuuagugagu c uuc uca    a
   acgaacca              uu                    - -   -   auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 2913323-2913432 [-]
intergenic
Database links

Mature sequence gma-miR166g

Accession MIMAT0020982
Sequence

76 - 

ucggaccaggcuucauucccc

 - 96

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).