Stem-loop sequence gma-MIR166f

AccessionMI0017832 (change log)
DescriptionGlycine max miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166f
(210 sentences)

Stem-loop
   augaag      a         u             c       cug   caaa   c 
5'       gaguug ggggaaugg gucugguucgaga cauucuu   aag    gau a
         |||||| ||||||||| ||||||||||||| |||||||   |||    |||  
3'       cucgau ccccuuacu cggaccaggcucu guaagag   uuc    cua u
   ----aa      c         u             a       ---   -cca   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 41798829-41798938 [+]
intergenic
Database links

Mature sequence gma-miR166f

Accession MIMAT0020981
Sequence

81 - 

ucggaccaggcuucauucccc

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).