Stem-loop sequence gma-MIR166e

AccessionMI0017831 (change log)
DescriptionGlycine max miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166e
(212 sentences)

Stem-loop
   ------aggug            uu g    cu         ucaaagagga      cac 
5'            uugaggggaaug  g cugg  cgaggcuuu          gguucu   u
              ||||||||||||  | ||||  |||||||||          ||||||    
3'            aacuccccuuac  c gacc  gcuucggaa          ucaaga   g
   uuuguguuaaa            uu g    ag         --------ua      acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 47978621-47978730 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR166e
gma-MIR166echr4: 47978621-47978730 [+]
gma-MIR166qchr4: 47978878-47979029 [+]
Database links

Mature sequence gma-miR166e

Accession MIMAT0020980
Sequence

75 - 

ucggaccaggcuucauucccc

 - 95

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).