Stem-loop sequence gma-MIR166d

AccessionMI0017830 (change log)
DescriptionGlycine max miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

36 open access papers mention gma-MIR166d
(210 sentences)

Stem-loop
   -ag      a         u             c       cu aagcaaa   c 
5'    gaguug ggggaaugg gucugguucgaga cauucuu  g       gau a
      |||||| ||||||||| ||||||||||||| |||||||  |       |||  
3'    cucgau ccccuuacu cggaccaggcucu guaagag  c       cua u
   aaa      c         u             a       uu -ccacua   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 44227240-44227349 [-]
intergenic
Database links

Mature sequence gma-miR166d

Accession MIMAT0020979
Sequence

80 - 

ucggaccaggcuucauucccc

 - 100

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).