Stem-loop sequence gma-MIR164c

AccessionMI0017827 (change log)
DescriptionGlycine max miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164c
(38 sentences)

Stem-loop
   cugagc    u       c      c   caa     --ac  -   a 
5'       aaga ggagaag agggca gug   uucua    uc aug a
         |||| ||||||| |||||| |||   |||||    || |||  
3'       uucu cuucuuu uuuugu cac   aagau    ag uac a
   ----uu    u       -      u   uaa     acua  a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 5194846-5194935 [-]
intergenic
Database links

Mature sequence gma-miR164c

Accession MIMAT0020976
Sequence

11 - 

uggagaagcagggcacgugc

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).