Stem-loop sequence gma-MIR164b

AccessionMI0017826 (change log)
DescriptionGlycine max miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164b
(37 sentences)

Stem-loop
   gcuccu           ca            --cuc  -ua   u  c 
5'       uguuggagaag  gggcacgugcaa     uc   ggc cu u
         |||||||||||  ||||||||||||     ||   ||| ||  
3'       acaaccucuuc  cucgugcacguu     ag   ccg ga u
   -----c           cc            uccca  uua   c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 1558481-1558570 [+]
intergenic
Database links

Mature sequence gma-miR164b

Accession MIMAT0020975
Sequence

10 - 

uggagaagcagggcacgugc

 - 29

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2