Stem-loop sequence gma-MIR162b

AccessionMI0017825 (change log)
DescriptionGlycine max miR162b stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

10 open access papers mention gma-MIR162b
(15 sentences)

Stem-loop
   u       a u a     g    c    c       uc   c  aauuugg     ga 
5'  gagguga g c cugga gcag gguu aucgauc  uuc ug       uugug  a
    ||||||| | | ||||| |||| |||| |||||||  ||| ||       |||||   
3'  uuucacu c g gaccu cguc ccaa uagcugg  aag ac       aacac  g
   -       - - c     a    u    a       cu   a  -----ga     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 1431946-1432055 [+]
intergenic
Database links

Mature sequence gma-miR162b

Accession MIMAT0020974
Sequence

80 - 

ucgauaaaccucugcauccag

 - 100

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).