Stem-loop sequence gma-MIR160e

AccessionMI0017824 (change log)
DescriptionGlycine max miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

20 open access papers mention gma-MIR160e
(59 sentences)

Stem-loop
   uacuuggc    c       c             ca   c      gg 
5'         gugc uggcucc uguaugccauuug  gag ccauca  a
           |||| ||||||| |||||||||||||  ||| ||||||   
3'         uacg accgagg gcgugcgguaagc  uuc gguagu  c
   --------    u       a             aa   c      ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 39255811-39255900 [-]
intergenic
Database links

Mature sequence gma-miR160e

Accession MIMAT0020973
Sequence

10 - 

ugccuggcucccuguaugcc

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).