Stem-loop sequence gma-MIR160d

AccessionMI0017823 (change log)
DescriptionGlycine max miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

20 open access papers mention gma-MIR160d
(60 sentences)

Stem-loop
   -----------   c       cu             a  cc       a 
5'            ugc uggcucc  guaugccauuugu ga  ccauuac a
              ||| |||||||  ||||||||||||| ||  |||||||  
3'            acg acugagg  uaugcgguaaacg uu  gguagug a
   uuuugugucgu   u       ag             a  cc       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 25235556-25235646 [-]
intergenic
Database links

Mature sequence gma-miR160d

Accession MIMAT0020972
Sequence

1 - 

ugccuggcucccuguaugcc

 - 20

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2