Stem-loop sequence gma-MIR156h

AccessionMI0017819 (change log)
DescriptionGlycine max miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156h
(164 sentences)

Stem-loop
   cuuagaaau        -    -        a        cu       g 
5'          ugacagaa gaga gugagcac cagaagca  ugguaua u
            |||||||| |||| |||||||| ||||||||  |||||||  
3'          acugucuu cucu cacucgug guuuucgu  gucauau u
   ---------        u    u        c        -u       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 5047205-5047294 [-]
intergenic
Database links

Mature sequence gma-miR156h

Accession MIMAT0020968
Sequence

10 - 

ugacagaagagagugagcac

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).