Stem-loop sequence emu-mir-2c

AccessionMI0017801 (change log)
DescriptionEchinococcus multilocularis miR-2c stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         ug     -      c    c    a    -  g 
5' gggcgu  uucgu cgucaa auug cugu gaca cg g
   ||||||  ||||| |||||| |||| |||| |||| || u
3' ucugcg  gagca guaguu uaac gaca cugu gc u
         gu     a      a    c    -    a  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI3) Overlapping transcripts
scaffold_007728: 10027399-10027476 [-]
intergenic
Clustered miRNAs
< 10kb from emu-mir-2c
emu-mir-71scaffold_007728: 10027494-10027579 [-]
emu-mir-2cscaffold_007728: 10027399-10027476 [-]
emu-mir-2bscaffold_007728: 10027294-10027369 [-]
Database links

Mature sequence emu-miR-2c-5p

Accession MIMAT0037437
Sequence

13 - 

ucgucaacauugccuguaga

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence emu-miR-2c-3p

Accession MIMAT0020257
Previous IDsemu-miR-2c
Sequence

47 - 

ucacagccaauauugaugaa

 - 66

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).
2
PMID:25659494 "High-throughput characterization of Echinococcus spp. metacestode miRNomes" Cucher M, Macchiaroli N, Kamenetzky L, Maldonado L, Brehm K, Rosenzvit MC Int J Parasitol. 45:253-267(2015).