Stem-loop sequence emu-mir-2a

Accession MI0017799
Description Echinococcus multilocularis miR-2a stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cuuc   c    cuac        --   a     g      c 
    gaa cucc    guuccagg  ggg uguga uuuaua a
    ||| ||||    ||||||||  ||| ||||| |||||| g
    cuu gagg    caagguuc  ccc acacu aaguau c
--uc   c    aaac        gu   g     -      c 
Get sequence
Genome context
Coordinates (WTSI3) Overlapping transcripts
scaffold_007760: 1900654-1900737 [+]
intergenic

Mature sequence emu-miR-2a

Accession MIMAT0020255
Sequence

50 - 

aaucacagcccugcuuggaacc

 - 71

Get sequence
Evidence not experimental

References

1
PMID:21219906 "Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes" Cucher M, Prada L, Mourglia-Ettlin G, Dematteis S, Camicia F, Asurmendi S, Rosenzvit M Int J Parasitol. 41:439-448(2011).