Stem-loop sequence cel-mir-4927

AccessionMI0017714 (change log)
DescriptionCaenorhabditis elegans miR-4927 stem-loop
Stem-loop
   g    --       a           au 
5'  uggg  uuuuuuc aaauuuuuuua  u
    ||||  ||||||| |||||||||||   
3'  accu  aaaaaag uuuaaaaaaau  a
   g    ug       g           aa 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 3507205-3507260 [-]
sense
M01F1.4b ; M01F1.4b; intron 6
M01F1.4a ; M01F1.4a; intron 7
Database links

Mature sequence cel-miR-4927

Accession MIMAT0020134
Sequence

1 - 

guggguuuuuucaaaauuuuuu

 - 22

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).